View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0759_high_40 (Length: 271)

Name: NF0759_high_40
Description: NF0759
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0759_high_40
NF0759_high_40
[»] chr1 (1 HSPs)
chr1 (66-229)||(51762004-51762167)


Alignment Details
Target: chr1 (Bit Score: 160; Significance: 2e-85; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 66 - 229
Target Start/End: Complemental strand, 51762167 - 51762004
Alignment:
66 aatggaatggattagatggatttggtgggcatagttctaatttaattaacaacaattatgaactagttcagaattgttttcatcctagtttggagaattc 165  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
51762167 aatggaatggattagatggatttggtgggcatagttctaatttaattaacaacaattatgaactagttcagaattgttttcatcctagtttggagaattc 51762068  T
166 tatcaaagatgttgctaaaatggttagattttttctcctaattaggaagttatatgctgatgat 229  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||    
51762067 tatcaaagatgttgctaaaatggttagattttttctcctaattaggaagttatatgctaatgat 51762004  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 5585 times since January 2019
Visitors: 4857