View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0759_high_43 (Length: 264)
Name: NF0759_high_43
Description: NF0759
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0759_high_43 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 12 - 230
Target Start/End: Original strand, 34531834 - 34532052
Alignment:
| Q |
12 |
gaggagcagagagtatccagtaaacactccaacttcaattgtctttttgggattcaacagcttcaaaagtagagtgattagttgaccagcctcaggtgca |
111 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34531834 |
gaggagaagagagtatccagtaaacactccaacttcaattgtctttttgggattcaacagcttcaaaagtagagtgattagttgaccagcctcaggtgca |
34531933 |
T |
|
| Q |
112 |
gttgctatgaaacccctgaatgaatatgaaaaccaagttaaccatcacaatatactaatgttttaaaattgaacagatcggttcaaccagttgaacaaag |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34531934 |
gttgctatgaaacccctgaatgaatatgaaaaccaagttaaccatcacaatatactaatgttttaaaattgaacagatcggttcaaccagttgaacaaag |
34532033 |
T |
|
| Q |
212 |
aaccgaccaactcgtcggt |
230 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
34532034 |
aaccgaccaactcgtcggt |
34532052 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 19 - 82
Target Start/End: Original strand, 7589109 - 7589172
Alignment:
| Q |
19 |
agagagtatccagtaaacactccaacttcaattgtctttttgggattcaacagcttcaaaagta |
82 |
Q |
| |
|
|||||||||||||| || ||||||| ||||||||||||||| | ||||||||||||||| |||| |
|
|
| T |
7589109 |
agagagtatccagtgaaaactccaatttcaattgtctttttagcattcaacagcttcaagagta |
7589172 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 19 - 59
Target Start/End: Complemental strand, 42830371 - 42830331
Alignment:
| Q |
19 |
agagagtatccagtaaacactccaacttcaattgtcttttt |
59 |
Q |
| |
|
|||||||||||||| || ||||| ||||||||||||||||| |
|
|
| T |
42830371 |
agagagtatccagtgaaaactcctacttcaattgtcttttt |
42830331 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 5148 times since January 2019
Visitors: 4845