View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0759_high_45 (Length: 258)
Name: NF0759_high_45
Description: NF0759
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0759_high_45 |
 |  |
|
[»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 230; Significance: 1e-127; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 21 - 258
Target Start/End: Complemental strand, 9484644 - 9484407
Alignment:
Q |
21 |
acatcatcatgttggtggatttggatttcatcaatcatcatcatctggtggtttagtagctactactgttggtgaaaataatagtggaaattattttcag |
120 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
9484644 |
acatcatcatgttggtggatttggatttcatcaatcatcatcatctggtggtttagtagctactactgttggtgaaaataatagtggaaattattttcag |
9484545 |
T |
 |
Q |
121 |
aaaattggattttctggatttgatatgccaacaggaacaaatttgggagtgggaggaatgagttttacttcaattttggggggtgcaaatcagcagatgc |
220 |
Q |
|
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
9484544 |
aaaattgggttttctggatttgatatgccaacaggaacaaatttgggagtgggagggatgagttttacttcaattttggggggtgcaaatcagcagatgc |
9484445 |
T |
 |
Q |
221 |
ctggtttggaattagggttgtcacaagatggacatatt |
258 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||| |
|
|
T |
9484444 |
ctggtttggaattagggttgtcacaagatggacatatt |
9484407 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 5642 times since January 2019
Visitors: 4858