View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0759_high_48 (Length: 251)
Name: NF0759_high_48
Description: NF0759
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0759_high_48 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 141; Significance: 5e-74; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 141; E-Value: 5e-74
Query Start/End: Original strand, 86 - 230
Target Start/End: Complemental strand, 40174489 - 40174345
Alignment:
Q |
86 |
gaagtggtgttccggtgtatggtccacctcggcctggcatgccccctccaccaaatgctccaaatcaacaacagcaacagtgattgtagaattgattggt |
185 |
Q |
|
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
40174489 |
gaagtggtgttcctgtgtatggtccacctcggcctggcatgccccctccaccaaatgctccaaatcaacaacagcaacagtgattgtagaattgattggt |
40174390 |
T |
 |
Q |
186 |
atgtttgtttctgttattttgctcttactttgtttgatgatgatg |
230 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
40174389 |
atgtttgtttctgttattttgctcttactttgtttgatgatgatg |
40174345 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 4475 times since January 2019
Visitors: 4835