View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0759_high_50 (Length: 251)
Name: NF0759_high_50
Description: NF0759
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0759_high_50 |
 | |
|
| [»] chr6 (2 HSPs) |
| |
|
Alignment Details
Target: chr6 (Bit Score: 94; Significance: 5e-46; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 94; E-Value: 5e-46
Query Start/End: Original strand, 158 - 251
Target Start/End: Original strand, 29446965 - 29447058
Alignment:
| Q |
158 |
aagattagtcccaacttatttttcagtctctttaggcctccaactggtttgttaggatttcctttactgtgatatccataagttttaaaacttc |
251 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29446965 |
aagattagtcccaacttatttttcagtctctttaggcctccaactggtttgttaggatttcctttactgtgatatccataagttttaaaacttc |
29447058 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 81; E-Value: 3e-38
Query Start/End: Original strand, 26 - 118
Target Start/End: Original strand, 29446833 - 29446925
Alignment:
| Q |
26 |
atcaaatgcttatttttgtgatggaaaacattctgcacgttattccacgttgaatttctaggaccatcataagattgaattctaccattatca |
118 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
29446833 |
atcaaatgcttgtttttgtgatggaaaacattctgcacgttattccacattgaatttctaggaccttcataagattgaattctaccattatca |
29446925 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 4064 times since January 2019
Visitors: 4827