View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0759_high_7 (Length: 479)
Name: NF0759_high_7
Description: NF0759
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0759_high_7 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 417; Significance: 0; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 417; E-Value: 0
Query Start/End: Original strand, 7 - 439
Target Start/End: Complemental strand, 40647051 - 40646619
Alignment:
| Q |
7 |
gtaaacaaggtagatatgttcaccggagatcgaaacgccgaggagtttcacgatgctgacgtggtggctgcgacagatggtggaaagaagctcttgcagc |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40647051 |
gtaaacaaggtagatatgttcaccggagatcgaaacgccgaggagtttcacgatgctgacgtggtggctgcgacagatggtggaaagaagctcttgcagc |
40646952 |
T |
 |
| Q |
107 |
tgttgggtttggagtttgcgacggaatttgcgttggaagatgatgacgtcagagttacgcaaggtgcaacgccaacatggtgttgaggaagagtagcgtt |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
40646951 |
tgttgggtttggagtttgcgacggaatttgcgttggaagatgatgacgtcagagttacgtaaggtgcaacgccagcatggtgttgaggaagagtagcgtt |
40646852 |
T |
 |
| Q |
207 |
tggagaggaagttgtttgtggcggaacagatttcggagaagtcgtagatgtttgggttttctgggagtgagttgcgaagagaggttaaggatgttctgct |
306 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40646851 |
tggagaggaagttatttgtggcggaacagatttcggagaagtcgtagatgtttgggttttctgggagtgagttgcgaagagaggttaaggatgttctgct |
40646752 |
T |
 |
| Q |
307 |
tgagattgatgtatcggttgagagatggaatccggttgaaccggcgtatgaggttgaagggttgtcggaaaatgataatgtttttgttttggtggttgca |
406 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
40646751 |
tgagattgatgtatcggttgagagatggaatccggttgaaccggcgtatgaggttgaagggttgtcggaaaatgatgatgtttttgttttggtggttgca |
40646652 |
T |
 |
| Q |
407 |
cgtgtgattgtggtacttgcacgtgtgggttta |
439 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
40646651 |
cgtgtgattgtggtacttgcacgtgtgggttta |
40646619 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University