View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0759_low_10 (Length: 500)
Name: NF0759_low_10
Description: NF0759
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0759_low_10 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 299; Significance: 1e-168; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 299; E-Value: 1e-168
Query Start/End: Original strand, 4 - 326
Target Start/End: Original strand, 19913245 - 19913567
Alignment:
Q |
4 |
ggaggagcagagagtttccaagtcggagaaagattccacctccaccgccgcaggagctaccggtggtggtggttcggaggaaattgagggttcaggtgta |
103 |
Q |
|
|
|||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
T |
19913245 |
ggagaagcagagagtttccaagtcggacaaagattccacctccaccgccgcaggagctaccggtggtggtggttcggaggaaattgaaggttcaggtgta |
19913344 |
T |
 |
Q |
104 |
acaatggggttgactaggtcagcggttggtgctgcaccaccaccttttaattgggctaatgcaacaacaaagcaagttgttcttggtgatgttttaggaa |
203 |
Q |
|
|
||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
19913345 |
acaatggggttgaataggtcaacggttggtgctgcaccaccaccttttaattgggctaatgcaacaacaaagcaagttgttcttggtgatgttttaggaa |
19913444 |
T |
 |
Q |
204 |
aagggaaaattggggttggttttcaaggattgtttacacaaccatcttctcaaggttcagtagattcacaaggtggaagttcttcatcattgtctgaaat |
303 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
19913445 |
aagggaaaattggggttggttttcaaggattgtttacacaaccatcttcgcaaggttcagtagattcacaaggtggaagttcttcatcattgtctgaaat |
19913544 |
T |
 |
Q |
304 |
ggatagcaagccttttctaggta |
326 |
Q |
|
|
||||||||||||||||||||||| |
|
|
T |
19913545 |
ggatagcaagccttttctaggta |
19913567 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 61; E-Value: 6e-26
Query Start/End: Original strand, 409 - 477
Target Start/End: Original strand, 19913658 - 19913726
Alignment:
Q |
409 |
atgattgttgattagtagtttccttatatgtatggtgttttgtctgtagattgtgtttgcttttgatga |
477 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||| |
|
|
T |
19913658 |
atgattgttgattagtagtttccttatatgtatggtgttttgtgtgtagactgtgtttgcttttgatga |
19913726 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 3429 times since January 2019
Visitors: 4814