View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0759_low_104 (Length: 249)
Name: NF0759_low_104
Description: NF0759
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0759_low_104 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 111; Significance: 4e-56; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 111; E-Value: 4e-56
Query Start/End: Original strand, 91 - 208
Target Start/End: Original strand, 9484109 - 9484227
Alignment:
Q |
91 |
gtagaatcctcacttgtatctgaagacttgagtactgtggaccaaaccaagccaaatccattttcta-tgaatttcactatttcctcaaactctaccaaa |
189 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
T |
9484109 |
gtagaatcctcacttgtatctgaagacttgagtactgtggaccaaaccaagccaaatccattttctattgaatttcactatttcctcaaactctaccaaa |
9484208 |
T |
 |
Q |
190 |
tatacaacaaataaaacac |
208 |
Q |
|
|
||||||||||||||||||| |
|
|
T |
9484209 |
tatacaacaaataaaacac |
9484227 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University