View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0759_low_107 (Length: 238)
Name: NF0759_low_107
Description: NF0759
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0759_low_107 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 139; Significance: 7e-73; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 139; E-Value: 7e-73
Query Start/End: Original strand, 50 - 224
Target Start/End: Original strand, 32333976 - 32334150
Alignment:
| Q |
50 |
acatcatcaccacaaactttaagtcattcaatttatgaatcatcttgcttatatgttgctcaacctcatattttccatccaacgtgagactttaactcac |
149 |
Q |
| |
|
|||| ||||||||||||||||||||||| |||||||||||||||| | |||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32333976 |
acattatcaccacaaactttaagtcatttaatttatgaatcatctcgtttatatgtcgctcaacctcatattttccatccaacgtgagactttaactcac |
32334075 |
T |
 |
| Q |
150 |
actaggctaatcacaacaatctctccctcaagtgtgagactctcttcatccttgatcaaacatgtagagtctctg |
224 |
Q |
| |
|
||| | |||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32334076 |
actcgactaatcacaacaatctcttccttaagtgtgagactctcttcatccttgatcaaacatgtagagtctctg |
32334150 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 35; Significance: 0.00000000008; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 101 - 151
Target Start/End: Complemental strand, 11442909 - 11442859
Alignment:
| Q |
101 |
tatgttgctcaacctcatattttccatccaacgtgagactttaactcacac |
151 |
Q |
| |
|
||||||||||||||||| | |||||||||||||| ||||||||||||||| |
|
|
| T |
11442909 |
tatgttgctcaacctcaactcttccatccaacgtgggactttaactcacac |
11442859 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 133 - 191
Target Start/End: Original strand, 44608208 - 44608266
Alignment:
| Q |
133 |
gtgagactttaactcacactaggctaatcacaacaatctctccctcaagtgtgagactc |
191 |
Q |
| |
|
|||||||||||||||||||| | ||||||||||||||||| ||||| ||||||||| |
|
|
| T |
44608208 |
gtgagactttaactcacacttaacacatcacaacaatctctccatcaagcgtgagactc |
44608266 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 138 - 186
Target Start/End: Complemental strand, 23041554 - 23041506
Alignment:
| Q |
138 |
actttaactcacactaggctaatcacaacaatctctccctcaagtgtga |
186 |
Q |
| |
|
||||||||||||||| | | ||||||||| |||||||||||||||||| |
|
|
| T |
23041554 |
actttaactcacacttgacatatcacaacattctctccctcaagtgtga |
23041506 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 92 - 168
Target Start/End: Original strand, 2517416 - 2517492
Alignment:
| Q |
92 |
tcttgcttatatgttgctcaacctcatattttccatccaacgtgagactttaactcacactaggctaatcacaacaa |
168 |
Q |
| |
|
|||||||||||||||||||||||| | | || ||| ||| ||| |||||||||||||| ||| | |||||||||| |
|
|
| T |
2517416 |
tcttgcttatatgttgctcaaccttaactctttcattcaatgtgggactttaactcacattagacctatcacaacaa |
2517492 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University