View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0759_low_109 (Length: 235)
Name: NF0759_low_109
Description: NF0759
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0759_low_109 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 102; Significance: 9e-51; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 102; E-Value: 9e-51
Query Start/End: Original strand, 50 - 151
Target Start/End: Complemental strand, 2782967 - 2782866
Alignment:
Q |
50 |
ccaagttaagtatatgcatatagtttttcaagtttataattagattttgcttcataatctctaagtgcatgtttggattttggactaattggtgttgagt |
149 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
2782967 |
ccaagttaagtatatgcatatagtttttcaagtttataattagattttgcttcataatctctaagtgcatgtttggattttggactaattggtgttgagt |
2782868 |
T |
 |
Q |
150 |
tt |
151 |
Q |
|
|
|| |
|
|
T |
2782867 |
tt |
2782866 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University