View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0759_low_112 (Length: 226)
Name: NF0759_low_112
Description: NF0759
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0759_low_112 |
 |  |
|
| [»] scaffold0376 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0376 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: scaffold0376
Description:
Target: scaffold0376; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 1 - 206
Target Start/End: Original strand, 9730 - 9935
Alignment:
| Q |
1 |
catgatatagacacaaacgatgatcgttcatcgaagtagcagctgtcaaatcatttctaatcctactattattcacttctttcaacttgttcatcaatgc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9730 |
catgatatagacacaaacgatgatcgttcatcgaagtagcagctgtcaaatcatttctgatcctactattattcacttctttcaacttgttcatcaatgc |
9829 |
T |
 |
| Q |
101 |
tttcaaaactttcatgaccttacgattattctcttcttcaggcagtcccgatttgggaatcgaattcaaaatcaatcttgttcttcagaccgtctcgcga |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
9830 |
tttcaaaactttcatgaccttacgattattctcttcttcaggcagtcccgatttgggaatcgaattcaaaatcaatcttgttcttcggaccgtctcgcga |
9929 |
T |
 |
| Q |
201 |
cattga |
206 |
Q |
| |
|
|||||| |
|
|
| T |
9930 |
cattga |
9935 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 20 - 81
Target Start/End: Complemental strand, 23252818 - 23252757
Alignment:
| Q |
20 |
atgatcgttcatcgaagtagcagctgtcaaatcatttctaatcctactattattcacttctt |
81 |
Q |
| |
|
||||||||||||| |||||||||| |||| ||||||| | ||||| |||||||||||||| |
|
|
| T |
23252818 |
atgatcgttcatcaaagtagcagcaatcaagtcatttcggaccctacaattattcacttctt |
23252757 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University