View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0759_low_113 (Length: 223)
Name: NF0759_low_113
Description: NF0759
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0759_low_113 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 77; Significance: 7e-36; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 77; E-Value: 7e-36
Query Start/End: Original strand, 99 - 194
Target Start/End: Original strand, 1500086 - 1500188
Alignment:
| Q |
99 |
aaccaaaaatacatataactttagaaaa-------tgcaaaattaccttaataaaattagagtttaatggaggtgcaatcatggtgtaaaatagttttac |
191 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1500086 |
aaccaaaaatacatataactttagaaaacccaaaatgcaaaattaccttaataaaattagagtttaatggaggtgcaatcatggtgtaaaatagttttac |
1500185 |
T |
 |
| Q |
192 |
acc |
194 |
Q |
| |
|
||| |
|
|
| T |
1500186 |
acc |
1500188 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University