View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0759_low_118 (Length: 219)

Name: NF0759_low_118
Description: NF0759
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0759_low_118
NF0759_low_118
[»] chr2 (1 HSPs)
chr2 (104-202)||(5991713-5991811)


Alignment Details
Target: chr2 (Bit Score: 95; Significance: 1e-46; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 95; E-Value: 1e-46
Query Start/End: Original strand, 104 - 202
Target Start/End: Complemental strand, 5991811 - 5991713
Alignment:
104 tcgccacctctcgccattaccaacaagctgaaacccttgtagaagaagtacttgccggcgcgtgtgaacccaccctccctcttttcaataccatcctcc 202  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||    
5991811 tcgccacctctcgccattaccaacaagctgaaacccttgtagaagaagtacttgccggcgcgtgtgaacccacactccctcttttcaataccatcctcc 5991713  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University