View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0759_low_121 (Length: 216)

Name: NF0759_low_121
Description: NF0759
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0759_low_121
NF0759_low_121
[»] chr7 (2 HSPs)
chr7 (90-138)||(27721838-27721886)
chr7 (166-201)||(27721807-27721842)


Alignment Details
Target: chr7 (Bit Score: 45; Significance: 8e-17; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 90 - 138
Target Start/End: Complemental strand, 27721886 - 27721838
Alignment:
90 gaaggtacaaaattctgtgcagtttcaaaagaactgcacaggggttgtt 138  Q
    ||||||| |||||||||||||||||||||||||||||||||||||||||    
27721886 gaaggtataaaattctgtgcagtttcaaaagaactgcacaggggttgtt 27721838  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 166 - 201
Target Start/End: Complemental strand, 27721842 - 27721807
Alignment:
166 ttgtttgttattgaggaagaacaacgtgtgatgatg 201  Q
    ||||||||||||||||||||||||||||||||||||    
27721842 ttgtttgttattgaggaagaacaacgtgtgatgatg 27721807  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 3708 times since January 2019
Visitors: 4818