View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0759_low_123 (Length: 215)
Name: NF0759_low_123
Description: NF0759
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0759_low_123 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 45; Significance: 8e-17; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 89 - 137
Target Start/End: Complemental strand, 27721886 - 27721838
Alignment:
| Q |
89 |
gaaggtacaaaattctgtgcagtttcaaaagaactgcacaggggttgtt |
137 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27721886 |
gaaggtataaaattctgtgcagtttcaaaagaactgcacaggggttgtt |
27721838 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 165 - 200
Target Start/End: Complemental strand, 27721842 - 27721807
Alignment:
| Q |
165 |
ttgtttgttattgaggaagaacaacgtgtgatgatg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
27721842 |
ttgtttgttattgaggaagaacaacgtgtgatgatg |
27721807 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 3481 times since January 2019
Visitors: 4814