View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0759_low_124 (Length: 213)
Name: NF0759_low_124
Description: NF0759
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0759_low_124 |
 |  |
|
[»] scaffold0070 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr8 (Bit Score: 128; Significance: 2e-66; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 128; E-Value: 2e-66
Query Start/End: Original strand, 34 - 190
Target Start/End: Original strand, 7247228 - 7247384
Alignment:
Q |
34 |
gaacctgtgatgcttctgnnnnnnnctctgcacctgcctttgttgttgctgctgctgcccttgtctctgacatcttttacagaaattcataaactaatgt |
133 |
Q |
|
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
T |
7247228 |
gaacctgtgatgcttctgtttttttctctgcacctgcctttgttgttgctgctgctgcccttgtctctgacatcttttacacaaattcataaactaatgt |
7247327 |
T |
 |
Q |
134 |
acaaagaaaaaattaaattcaaatgcatgttagtccatgcacctttggttttgctgt |
190 |
Q |
|
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
T |
7247328 |
acaaagaaaaaattaaatgcaaatgcatgttagtccatgcacctttggttttgctgt |
7247384 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 86 - 181
Target Start/End: Complemental strand, 25321474 - 25321379
Alignment:
Q |
86 |
tgctgcccttgtctctgacatcttttacagaaattcataaactaatgtacaaagaaaaaattaaattcaaatgcatgttagtccatgcacctttgg |
181 |
Q |
|
|
||||||| |||||||| |||||||||||| ||||||| || |||||||||| ||||| | || |||||||||||||| |||||| ||||||||| |
|
|
T |
25321474 |
tgctgcctttgtctctaacatcttttacaaaaattcactaataaatgtacaaataaaaactaaatttcaaatgcatgttggtccattcacctttgg |
25321379 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0070 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 1)
Name: scaffold0070
Description:
Target: scaffold0070; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 86 - 181
Target Start/End: Original strand, 18409 - 18505
Alignment:
Q |
86 |
tgctgcccttgtctctgacatctttt-acagaaattcataaactaatgtacaaagaaaaaattaaattcaaatgcatgttagtccatgcacctttgg |
181 |
Q |
|
|
||||||| ||||| |||||||||||| ||| ||||||| || |||||||||||||||| | || |||||||||||||| |||||| ||||||||| |
|
|
T |
18409 |
tgctgcctttgtcactgacatctttttacaaaaattcacaaggaaatgtacaaagaaaaactaaatttcaaatgcatgttggtccattcacctttgg |
18505 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 4394 times since January 2019
Visitors: 4835