View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0759_low_2 (Length: 639)
Name: NF0759_low_2
Description: NF0759
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0759_low_2 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 87; Significance: 2e-41; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 87; E-Value: 2e-41
Query Start/End: Original strand, 154 - 267
Target Start/End: Original strand, 24704391 - 24704502
Alignment:
| Q |
154 |
ataagtgttggcggaatatccagtttctgcggaatacatgccaaagtagaccgtatagtttcttttccctcttattttatttcttgttatccaaattcaa |
253 |
Q |
| |
|
|||||||||||| ||||||||||||| |||||||||||||| ||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24704391 |
ataagtgttggcagaatatccagtttatgcggaatacatgctaaaatagaccgta--gtttcttttccctcttattttatttcttgttatccaaattcaa |
24704488 |
T |
|
| Q |
254 |
agtttagaccgaga |
267 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
24704489 |
agtttagaccgaga |
24704502 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 53 - 106
Target Start/End: Original strand, 24704291 - 24704344
Alignment:
| Q |
53 |
aaatgttctttccatcagacaaggataaaatattcaaaataaaatgtggcctta |
106 |
Q |
| |
|
||||||||||||||||| | |||||||||||||||||||||| ||||||||||| |
|
|
| T |
24704291 |
aaatgttctttccatcaaataaggataaaatattcaaaataatatgtggcctta |
24704344 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 29; Significance: 0.0000009; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 21 - 57
Target Start/End: Original strand, 42824078 - 42824114
Alignment:
| Q |
21 |
ataaatagttgaattttaaatgaagtcagagaaaatg |
57 |
Q |
| |
|
||||||| ||||||||||||||||||| ||||||||| |
|
|
| T |
42824078 |
ataaatacttgaattttaaatgaagtcggagaaaatg |
42824114 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 3228 times since January 2019
Visitors: 4808