View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0759_low_24 (Length: 409)
Name: NF0759_low_24
Description: NF0759
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0759_low_24 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 282; Significance: 1e-158; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 282; E-Value: 1e-158
Query Start/End: Original strand, 21 - 364
Target Start/End: Complemental strand, 34325335 - 34325001
Alignment:
| Q |
21 |
tgcctattttacttttatggggagatgaagatccctttactccaattgatggacctgttggaaagtacttttcttcattgccttctcaacaagaaaatgt |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34325335 |
tgcctattttacttttatggggagatgaagatccctttactccaattgatggacctgttggaaagtacttttcttcattgccttctcaacaagaaaatgt |
34325236 |
T |
 |
| Q |
121 |
tcaactgttcatgcttgaaggggttggacattgtcctcatgatgacaggcctgaattagtccatgaaaaattgcttccatggttggccactcttaaaaat |
220 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
34325235 |
tcaacttttcatgcttgaaggggttggacattgtcctcatgatgacaggcctgaattagtccatgaaaaattgcttccatggttggccactctttaaaat |
34325136 |
T |
 |
| Q |
221 |
tcataggaaacacatgcaggactatacaaaccttttatagtttataattggtgactcaattaatcctcatgataaactgtcacatatattccatatatgt |
320 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| || |||| ||||| ||||||||||||||| |||||| |
|
|
| T |
34325135 |
tcataggaaacacatgcagtactatacaaaccttttatagtttataattggtgactc----aaacctc---ataaattgtcacatatattcc--atatgt |
34325045 |
T |
 |
| Q |
321 |
atagattatgttgtttataaattgtttgtattcatttacaaccc |
364 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34325044 |
atagattatgttgtttataaattgtttgtattcatttacaaccc |
34325001 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University