View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0759_low_27 (Length: 399)
Name: NF0759_low_27
Description: NF0759
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0759_low_27 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 146; Significance: 8e-77; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 146; E-Value: 8e-77
Query Start/End: Original strand, 81 - 290
Target Start/End: Complemental strand, 9641969 - 9641760
Alignment:
| Q |
81 |
actatcacgatgtcagaatcaattacatgtgtaactttagatgcaatgataaatattgttaaatatttttaactgacagtgtnnnnnnnnnttccactga |
180 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||||||| |
|
|
| T |
9641969 |
actatcacgatgtcagaatcaattacatgtgtaactttagatgcaatgataaatattattaaatatttttaactgacagtgtaaaaaaaaagtccactga |
9641870 |
T |
 |
| Q |
181 |
caatgtatatgaattaaataannnnnnnaatgattttatcttacatgtttaaggttcttttcttgtttaaatataggtttcccaaactgaagtgaccctt |
280 |
Q |
| |
|
||||||||||||||||||||| |||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9641869 |
caatgtatatgaattaaataatttttttaatgatgttatctaacatgtttaaggttcttttcttgtttaaatataggtttcccaaactgaagtgaccctt |
9641770 |
T |
 |
| Q |
281 |
tgacttgaaa |
290 |
Q |
| |
|
|||||||||| |
|
|
| T |
9641769 |
tgacttgaaa |
9641760 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University