View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0759_low_31 (Length: 395)
Name: NF0759_low_31
Description: NF0759
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0759_low_31 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 293; Significance: 1e-164; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 293; E-Value: 1e-164
Query Start/End: Original strand, 1 - 305
Target Start/End: Original strand, 29425569 - 29425873
Alignment:
Q |
1 |
tagttaccggagtccggcgaacaccaaattggagcttaacgaatccgataacaggtccagtgtggcgtttcatcatctcctctttgatcttcgattcatc |
100 |
Q |
|
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
29425569 |
tagttaccggagtccggcgaacaccaaatcggagcttaacgaatccgataacaggtccagtgtggcgtttcatcatctcctctttgatcttcgattcatc |
29425668 |
T |
 |
Q |
101 |
catcttggttaaatcagcgggagcgaaagagggtgaaggtttcttgccccattccttccaatcatcatcctcctcatcgtcgaacacgtcgtccaattcg |
200 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
29425669 |
catcttggttaaatcagcgggagcgaaagagggtgaaggtttcttgccccattccttccaatcatcatcctcctcatcgtcgaacacgtcgtccaattcg |
29425768 |
T |
 |
Q |
201 |
tcggtgatgtggaccttgcgttttccggcgagggtaaaatgggaatttagggagatcagaagaagaagggaaagtagaaagagagttgtgaagttcatga |
300 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||| |
|
|
T |
29425769 |
tcggtgatgtggaccttgcgttttccggcgagggtaaaatgggaatttagggagattagaagaagaagggaaagtagaaagagagttgagaagttcatga |
29425868 |
T |
 |
Q |
301 |
tgatg |
305 |
Q |
|
|
||||| |
|
|
T |
29425869 |
tgatg |
29425873 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University