View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0759_low_40 (Length: 376)
Name: NF0759_low_40
Description: NF0759
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0759_low_40 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 245; Significance: 1e-136; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 245; E-Value: 1e-136
Query Start/End: Original strand, 1 - 261
Target Start/End: Complemental strand, 5027249 - 5026989
Alignment:
| Q |
1 |
gaatgttgagaagaatttgaagctgttgatgagatgatgaacgccaattaggaaaacccggtgaaactggaagaccttgttggagaatagcatgaagatc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
5027249 |
gaatgttgagaagaatttgaagctgttgatgagatgatgaacgccaattaggaaaacccggtgacactggaagaccttgttggagaatagcatgaagatc |
5027150 |
T |
|
| Q |
101 |
aggtgggaatttaaggttgaattttgattcgagatgttgaaattctgattcggtgagtccttgttcgataataatgttggaggatttgaggttttgtatg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
5027149 |
aggtgggaatttaaggttgaattttgattcgagatgttgaaattctgattcggtgagtccttgttcgataataatgttagaggatttgaggttttgtatg |
5027050 |
T |
|
| Q |
201 |
agattgtttgcataagttgtgaatgagaaacatattcttcgtttcttgggtctaagtggtg |
261 |
Q |
| |
|
|||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5027049 |
agatcgtttgcatatgttgtgaatgagaaacatattcttcgtttcttgggtctaagtggtg |
5026989 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 5005 times since January 2019
Visitors: 4844