View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0759_low_5 (Length: 528)
Name: NF0759_low_5
Description: NF0759
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0759_low_5 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 249; Significance: 1e-138; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 249; E-Value: 1e-138
Query Start/End: Original strand, 6 - 262
Target Start/End: Original strand, 33288320 - 33288576
Alignment:
| Q |
6 |
agcagcacagagacaacgaaggaaaacagaatgaagagtagacaattgaggaagtagggtttcaccgatataatgcgccaattgcgcaaaaacaagcaac |
105 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
33288320 |
agcagcactgagacaacgaaggaaaacagaatgaagagtagacaattgaggaagtagggtttcaccaatataatgcgccaattgcgcaaaaacaagcaac |
33288419 |
T |
 |
| Q |
106 |
gcaatctcctgaagcctagcatcattggaagtaacccattgaaaaagaagcggaagcaagtcaggccaagaagacaggtcatcagagagaagagcagaag |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33288420 |
gcaatctcctgaagcctagcatcattggaagtaacccattgaaaaagaagcggaagcaagtcaggccaagaagacaggtcatcagagagaagagcagaag |
33288519 |
T |
 |
| Q |
206 |
cgagttccgaaacggtgtcgcatagcttcttaacgatggatttgattggttcttgat |
262 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33288520 |
cgagttccgaaacggtgtcgcatagcttcttaacgatggatttgattggttcttgat |
33288576 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 174; E-Value: 2e-93
Query Start/End: Original strand, 315 - 504
Target Start/End: Original strand, 33288629 - 33288818
Alignment:
| Q |
315 |
gtgtgggtagatgaaagagtcgtcgtggtggcgcgtgagatggcgacggaggaggatggtggacatggttcgtgtttcggggttaggggaagtgtggaga |
414 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
33288629 |
gtgtgggtagatgaaagagtcgtcgtggtggcgcgtgagatgacgacggaggaggatggtggacatggttcgtgtttcggggttagaggaagtgtggaga |
33288728 |
T |
 |
| Q |
415 |
agatgggagagtttgaggattagggaatcggggtaggtttgtttgcagagattgaagagattttcagcttgggaacgttggtcgttgatg |
504 |
Q |
| |
|
|||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33288729 |
agatgggagagtttgaggattaaggaatcgggataggtttgtttgcagagattgaagagattttcagcttgggaacgttggtcgttgatg |
33288818 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University