View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0759_low_62 (Length: 307)
Name: NF0759_low_62
Description: NF0759
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0759_low_62 |
 |  |
|
[»] scaffold0728 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0728 (Bit Score: 170; Significance: 3e-91; HSPs: 1)
Name: scaffold0728
Description:
Target: scaffold0728; HSP #1
Raw Score: 170; E-Value: 3e-91
Query Start/End: Original strand, 1 - 217
Target Start/End: Original strand, 2677 - 2890
Alignment:
Q |
1 |
ttactctcttgctctcatgtttcatcactatcatcgtccgagattcaaacctaacccttctctctttcacatctcattgtttcatacacttcttactccg |
100 |
Q |
|
|
|||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
2677 |
ttactctcttgctctcatgtttcatcactactatcgtccgagatttaaacctaacccttctctctttcacatctcattgtttcatacacttcttactccg |
2776 |
T |
 |
Q |
101 |
atcatagttctttcggttttctaagacgatcgttatcttctacaccggttaccggtaacaatcactcatactttgatcannnnnnnnnagtcttaattct |
200 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
T |
2777 |
atcatagttctttcggttttctaagacgatcgttatcttctacaccggttaccggtaacaatcactcatactttgatcattttttt---gtcttaattct |
2873 |
T |
 |
Q |
201 |
gttgatgaatgatgatg |
217 |
Q |
|
|
||||||||||||||||| |
|
|
T |
2874 |
gttgatgaatgatgatg |
2890 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 170; Significance: 3e-91; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 170; E-Value: 3e-91
Query Start/End: Original strand, 1 - 217
Target Start/End: Original strand, 19407111 - 19407324
Alignment:
Q |
1 |
ttactctcttgctctcatgtttcatcactatcatcgtccgagattcaaacctaacccttctctctttcacatctcattgtttcatacacttcttactccg |
100 |
Q |
|
|
|||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
19407111 |
ttactctcttgctctcatgtttcatcactactatcgtccgagatttaaacctaacccttctctctttcacatctcattgtttcatacacttcttactccg |
19407210 |
T |
 |
Q |
101 |
atcatagttctttcggttttctaagacgatcgttatcttctacaccggttaccggtaacaatcactcatactttgatcannnnnnnnnagtcttaattct |
200 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
T |
19407211 |
atcatagttctttcggttttctaagacgatcgttatcttctacaccggttaccggtaacaatcactcatactttgatcattttttt---gtcttaattct |
19407307 |
T |
 |
Q |
201 |
gttgatgaatgatgatg |
217 |
Q |
|
|
||||||||||||||||| |
|
|
T |
19407308 |
gttgatgaatgatgatg |
19407324 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University