View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0759_low_66 (Length: 298)
Name: NF0759_low_66
Description: NF0759
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0759_low_66 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 6 - 264
Target Start/End: Original strand, 37430494 - 37430752
Alignment:
Q |
6 |
aggattttggatttgattattttagcctatatctatagaggttatgaagaggtttgaaagatgcagaagcatgacctacaaagcattgattgcaaacata |
105 |
Q |
|
|
|||||||| |||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||| |
|
|
T |
37430494 |
aggattttttatttgattattttagcctctatctatagatgttatgaagaggtttgaaagatgcagaagcatgacctactaagcattgattgcaaccata |
37430593 |
T |
 |
Q |
106 |
tagtagttgataagaagaatgaataagggaaaagaatattgcatatatgtcttattctctttgtatttgaaattgtggtagtcttgtcttgtgcattgga |
205 |
Q |
|
|
|||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
37430594 |
tagtagttgataagcagaatgaatcagggaaaagaatattgcatatatgtcttattctctttgtatttgaaattgtggtagtcttgtcttgtgcattgga |
37430693 |
T |
 |
Q |
206 |
ctattagtgttttcctgtcctggtttgacaaatctttcctggtgttctggtttgacaaa |
264 |
Q |
|
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
T |
37430694 |
ctattagtgttttcctgtcctggtttgacaaatcttttctggtgttctggtttgacaaa |
37430752 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University