View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0759_low_69 (Length: 293)
Name: NF0759_low_69
Description: NF0759
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0759_low_69 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 165; Significance: 3e-88; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 165; E-Value: 3e-88
Query Start/End: Original strand, 64 - 240
Target Start/End: Complemental strand, 8679950 - 8679774
Alignment:
Q |
64 |
catcatcaatagaggataagatgttaaaataaaatactttccattaaattatataggatgatatgtaagaggtcaagtaagattgaaatgaaaacaaaaa |
163 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
8679950 |
catcatcaatagaggataagatgttaaaataaaatactttccattaaattatataggatgatatgtaagaggtcaagtaagattgaaatgaaaacaaaaa |
8679851 |
T |
 |
Q |
164 |
ctatcttaacaagaattcgaatattgctaaaattatcttgaagcataattacatttttcactaccatatcttttcat |
240 |
Q |
|
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
T |
8679850 |
ctatcttaacaagaattcagatattgctaaaattatcttgaagcataattacatttttcactaccatatcctttcat |
8679774 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University