View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0759_low_70 (Length: 293)
Name: NF0759_low_70
Description: NF0759
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0759_low_70 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 177; Significance: 2e-95; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 47 - 223
Target Start/End: Original strand, 3722544 - 3722720
Alignment:
| Q |
47 |
gagtgagatgaaggaagaaatggttaattgagtttacttgtacttggggtaaaaagttgttccttgctttactatgtaacaaaatattttacttttgcca |
146 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3722544 |
gagtgagatgaaggaagaaatggttaattgagtttacttgtacttggggtaaaaagttgttccttgctttactatgtaacaaaatattttacttttgcca |
3722643 |
T |
|
| Q |
147 |
tgtacgtctatgttgtcaccccttgttttgttctatctcatagtaatttttcaaatcaaaaattaaaataatattta |
223 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3722644 |
tgtacgtctatgttgtcaccccttgttttgttctatctcatagtaatttttcaaatcaaaaattaaaataatattta |
3722720 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 4815 times since January 2019
Visitors: 4839