View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0759_low_71 (Length: 292)
Name: NF0759_low_71
Description: NF0759
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0759_low_71 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 149; Significance: 1e-78; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 149; E-Value: 1e-78
Query Start/End: Original strand, 1 - 237
Target Start/End: Original strand, 7724389 - 7724606
Alignment:
| Q |
1 |
ttctttgatgattcagacattccctgatctttcgaactacaaatgcatagaaaatatagcatagtagctataagagtactcaaaacttagttgcatgatg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||| ||||||||||||||||||| |
|
|
| T |
7724389 |
ttctttgatgattcagacattccctgatctttcgaactacaaatgcaaagaaaatatagcata-------------tac--aaaacttagttgcatgatg |
7724473 |
T |
 |
| Q |
101 |
catatacaaaaattggagaaaattcatatgatttgtttccaaacaaatcaaaaggagagtgaaacaattcatacatattaaacttcgaaaaatgagttac |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||| |
|
|
| T |
7724474 |
catatacaaaaattggagaaaattcatatgatttgtttccaaacaaatcaaaaggagagtgaaacaatt----catatcaaacttcgaaaaatgagttac |
7724569 |
T |
 |
| Q |
201 |
tatgactgattatatacaaagaattcatggcgtctgg |
237 |
Q |
| |
|
|||||| |||||||||||||||||||||||| ||||| |
|
|
| T |
7724570 |
tatgaccgattatatacaaagaattcatggcatctgg |
7724606 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University