View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0759_low_76 (Length: 282)
Name: NF0759_low_76
Description: NF0759
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0759_low_76 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 1 - 193
Target Start/End: Complemental strand, 9699863 - 9699671
Alignment:
| Q |
1 |
tcagtcatcctgaaagaaaacaatttactcaaccattacctgaacttatattgataagaagtacatcagggtgataagtaggcaaagatccaccgatcag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9699863 |
tcagtcatcctgaaagaaaacaatttactcaaccattacctgaacttatattgataagaagtacatcagggtgataagtaggcaaagatccaccgatcag |
9699764 |
T |
 |
| Q |
101 |
atcagctacttctaagatgctccacaaaccaaccttggtaaggagttcagattttaattgttccttggcaagagtcacgctgctgcacaggtt |
193 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||| |
|
|
| T |
9699763 |
atcagctacttctaagatgctccacaaaccaaccttggtaaggagttcagattttaattgttccttggcaagaatcacgctgctgtacaggtt |
9699671 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University