View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0759_low_77 (Length: 280)
Name: NF0759_low_77
Description: NF0759
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0759_low_77 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 1 - 233
Target Start/End: Original strand, 5768472 - 5768705
Alignment:
| Q |
1 |
atggatatggcctgcttcattggttggaattgaaaacataacaattt-gcagtcaaagttatttctattttgattcaacttgcaagttatggtttggtgt |
99 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5768472 |
atggatatggtctgcttcattggttggaattgaaaacataacaattttgcagtcaaagttatttctattttgattcaacttgcaagttatggtttggtgt |
5768571 |
T |
 |
| Q |
100 |
tcgtattcttctacaacgtgaatcagcatttggatcttatttcatgttcaggattacaagttaggttgcatgcttgagtagtgtagtggatgtccttggt |
199 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5768572 |
tcgtattcttctacaacgtgaattagcatttggatcttatttcatgttcaggattacaagttaggttgcatgcttgagtagtgtagtggatgtccttggt |
5768671 |
T |
 |
| Q |
200 |
ttatctcactgggcacagtaaggtgcagagcaaa |
233 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
5768672 |
ttatctcactgggcacagtaaggtgcagagcaaa |
5768705 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University