View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0759_low_85 (Length: 271)
Name: NF0759_low_85
Description: NF0759
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0759_low_85 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 160; Significance: 2e-85; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 66 - 229
Target Start/End: Complemental strand, 51762167 - 51762004
Alignment:
| Q |
66 |
aatggaatggattagatggatttggtgggcatagttctaatttaattaacaacaattatgaactagttcagaattgttttcatcctagtttggagaattc |
165 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51762167 |
aatggaatggattagatggatttggtgggcatagttctaatttaattaacaacaattatgaactagttcagaattgttttcatcctagtttggagaattc |
51762068 |
T |
 |
| Q |
166 |
tatcaaagatgttgctaaaatggttagattttttctcctaattaggaagttatatgctgatgat |
229 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
51762067 |
tatcaaagatgttgctaaaatggttagattttttctcctaattaggaagttatatgctaatgat |
51762004 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University