View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0759_low_90 (Length: 264)
Name: NF0759_low_90
Description: NF0759
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0759_low_90 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 182; Significance: 2e-98; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 26 - 211
Target Start/End: Original strand, 1138998 - 1139183
Alignment:
Q |
26 |
aatatgagaaagtgctggaggagaaaaggaaagccctgaatgttaagactgatggaggaagaaaggtggataccaaggagtttgaatccttgaagcctct |
125 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
1138998 |
aatatgagaaagtgctggaggagaaaaggaaagccctgaatgttaagactgatggaggaagaaaggtggataccaaggagtttgaatccttgaagcctct |
1139097 |
T |
 |
Q |
126 |
gtcatgcaagaaagagaatgatgagatctttgccaaactggttagttttttatatccttcttttactcccaatttgcagttccaag |
211 |
Q |
|
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
1139098 |
gtcatgcaagaaagagaatgacgagatctttgccaaactggttagttttttatatccttcttttactcccaatttgcagttccaag |
1139183 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University