View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0759_low_95 (Length: 258)
Name: NF0759_low_95
Description: NF0759
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0759_low_95 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 30 - 258
Target Start/End: Complemental strand, 47454847 - 47454623
Alignment:
| Q |
30 |
gtttcttgaatccttccgtatcctccgccacaccaactaattcttatttatttatttaattaatataagaaaatactannnnnnnnnngtatgaataaca |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
47454847 |
gtttcttgaatccttccgtatcctccgccacaccaactaattcttatttatttatttaattaatataagaaaatactattttttt----tatgaataaca |
47454752 |
T |
 |
| Q |
130 |
tatactctacatataaatgtataggctaatcataaagttttcaatttaataaaatcacaatatatgaattgaaatttaacgttgttaagttgatgaaatt |
229 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47454751 |
tatactctacatgtaaatgtataggctaatcataaagttttcaatttattaaaatcacaatatatgaattgaaatttaacgttgttaagttgatgaaatt |
47454652 |
T |
 |
| Q |
230 |
aatcaattaaatgttcttataaatattca |
258 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
47454651 |
aatcaattaaatgttcttataaatattca |
47454623 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University