View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0759_low_97 (Length: 252)
Name: NF0759_low_97
Description: NF0759
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0759_low_97 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 195; Significance: 1e-106; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 16 - 222
Target Start/End: Original strand, 29310284 - 29310490
Alignment:
| Q |
16 |
atatcaggctgtcaatttgatctgagccgtctattaatgaatttacagcataaaccatataataatgcaacatattctttgccctactgaaataaatata |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29310284 |
atatcaggctgtcaatttgatctgagccgtctattaatgaatttacagcataaacaatataataatgcaacatattctttgccctactgaaataaatata |
29310383 |
T |
 |
| Q |
116 |
atgctaatttcatggtctattggtttctttttaatacactagtatgaagaatgatatcaagtctggacagttaaatagttattgttttattatgcaaatg |
215 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29310384 |
atgctaatttcatggtatattggtttctttttaatacactagtatgaagaatgatatcaagtctggacagttaaatagttattgttttattatgcaaatc |
29310483 |
T |
 |
| Q |
216 |
ttgtttg |
222 |
Q |
| |
|
||||||| |
|
|
| T |
29310484 |
ttgtttg |
29310490 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 90 - 195
Target Start/End: Original strand, 29366108 - 29366211
Alignment:
| Q |
90 |
ttctttgccctactgaaataaatataatgctaatttcatggtctattggtttctttttaatacactagtatgaagaatgatatcaagtctggacagttaa |
189 |
Q |
| |
|
||||||||||||| |||||||||| ||||||||||||| ||||||||| ||||| ||| |||||||||||||||| || ||||||||||||| ||| | |
|
|
| T |
29366108 |
ttctttgccctacggaaataaatacaatgctaatttcacggtctattgatttctactta--acactagtatgaagaaagacatcaagtctggaccgttta |
29366205 |
T |
 |
| Q |
190 |
atagtt |
195 |
Q |
| |
|
|||||| |
|
|
| T |
29366206 |
atagtt |
29366211 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 35; Significance: 0.00000000009; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 114 - 175
Target Start/End: Complemental strand, 12519507 - 12519448
Alignment:
| Q |
114 |
taatgctaatttcatggtctattggtttctttttaatacactagtatgaagaatgatatcaa |
175 |
Q |
| |
|
||||||||||||||||| |||||| ||||||| |||| ||||||||||||| ||||||||| |
|
|
| T |
12519507 |
taatgctaatttcatggcctattgatttctttgtaat--actagtatgaagattgatatcaa |
12519448 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University