View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0759_low_99 (Length: 251)
Name: NF0759_low_99
Description: NF0759
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0759_low_99 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 30 - 251
Target Start/End: Complemental strand, 41813235 - 41813014
Alignment:
| Q |
30 |
aatttggtgctggtttaaactttttagggtcaatattaaactttcggctaaattagaacattcagaatctgcttttgggattgctctattgctgagtatg |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41813235 |
aatttggtgctggtttaaactttttagggtcaatattaaactttcggctaaattagaacattcagaatctgcttttgggattgctctattgctgagtatg |
41813136 |
T |
|
| Q |
130 |
gttcgtagttattgataagtggataggtcgatcaagcagagcaagagcgaccctttcggccaggcccaaacattttttgggttaatcttatcaagtccta |
229 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41813135 |
gttcgtagttattgataagtggataggtcgatcaagcagagcaagagcgaccctttcggccaggcccaaacattttttgggttaatcttatcaagtccta |
41813036 |
T |
|
| Q |
230 |
gtttgtaacagaatatgttcac |
251 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
41813035 |
gtttgtaacagaatatgttcac |
41813014 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 4727 times since January 2019
Visitors: 4839