View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0760_high_20 (Length: 270)
Name: NF0760_high_20
Description: NF0760
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0760_high_20 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 237; Significance: 1e-131; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 237; E-Value: 1e-131
Query Start/End: Original strand, 1 - 245
Target Start/End: Original strand, 2018501 - 2018745
Alignment:
| Q |
1 |
ccttctgtcaaagagatggaaaccactctggctctccctccgttccttcgaccttgatgacaactacttttccgacttccacaggttttccaatttcttc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
2018501 |
ccttctgtcaaagagatggaaaccactctggctctccttccgttccttcgaccttgatgacaactacttttccgacttccacaggttttccaatttcgtc |
2018600 |
T |
 |
| Q |
101 |
acctcatcaccacaatccattcaatccttacgcctcacttgtggctcccattttaccttcgagttcgaggacgtcgaagaagatgctttcgacctcttcc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2018601 |
acctcatcaccacaatccattcaatccttacgcctcacttgtggctcccattttaccttcgagttcgaggacgtcgaagaagatgctttcgacctcttcc |
2018700 |
T |
 |
| Q |
201 |
tttatagactgtcgttcaaaggaattcaggaactcgatctctgct |
245 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2018701 |
tttatagactgtcgttcaaaggaattcaggaactcgatctctgct |
2018745 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 1 - 51
Target Start/End: Original strand, 2005650 - 2005700
Alignment:
| Q |
1 |
ccttctgtcaaagagatggaaaccactctggctctccctccgttccttcga |
51 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||| |||||||||||||| |
|
|
| T |
2005650 |
ccttctgtcaaagagatggaaaccactttggctctcactccgttccttcga |
2005700 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 2 - 96
Target Start/End: Original strand, 2011825 - 2011919
Alignment:
| Q |
2 |
cttctgtcaaagagatggaaaccactctggctctccctccgttccttcgaccttgatgacaactacttttccgacttccacaggttttccaattt |
96 |
Q |
| |
|
||||| |||||||||||||||||||| |||||||| ||||||||||| ||| | |||||| |||||| | ||||||| || ||||||| |||| |
|
|
| T |
2011825 |
cttctatcaaagagatggaaaccactttggctctcgctccgttcctttgacttccatgacagatactttcctgacttcctcaagttttccgattt |
2011919 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University