View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0760_high_27 (Length: 252)

Name: NF0760_high_27
Description: NF0760
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0760_high_27
NF0760_high_27
[»] chr1 (1 HSPs)
chr1 (15-127)||(40225297-40225409)
[»] chr2 (1 HSPs)
chr2 (15-77)||(18106925-18106987)


Alignment Details
Target: chr1 (Bit Score: 109; Significance: 6e-55; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 109; E-Value: 6e-55
Query Start/End: Original strand, 15 - 127
Target Start/End: Original strand, 40225297 - 40225409
Alignment:
15 gagatgtcgggaagaacaatgacgttggttcgaaatctggctttagaattgtcgcaggtgaaaacagaggtttgttgttgtttttagagagaggaaaaag 114  Q
    |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
40225297 gagatgtcgggaagaacaatgatgttggttcgaaatctggctttagaattgtcgcaggtgaaaacagaggtttgttgttgtttttagagagaggaaaaag 40225396  T
115 ggtttaggcttat 127  Q
    |||||||||||||    
40225397 ggtttaggcttat 40225409  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 47; Significance: 6e-18; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 15 - 77
Target Start/End: Original strand, 18106925 - 18106987
Alignment:
15 gagatgtcgggaagaacaatgacgttggttcgaaatctggctttagaattgtcgcaggtgaaa 77  Q
    |||||||||||||||||||||| ||||| |||||||||| ||||| |||||||||||||||||    
18106925 gagatgtcgggaagaacaatgatgttgggtcgaaatctgtctttaaaattgtcgcaggtgaaa 18106987  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 3661 times since January 2019
Visitors: 4816