View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0760_high_33 (Length: 248)
Name: NF0760_high_33
Description: NF0760
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0760_high_33 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 75; Significance: 1e-34; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 134 - 228
Target Start/End: Complemental strand, 29060324 - 29060230
Alignment:
| Q |
134 |
tgaacaagtaagaataaggacaccgttgattttttctttcttgatttaatggttattgtgccatttgagatgttgttgatgatgattatgatgat |
228 |
Q |
| |
|
|||||||||||||||||||||||| |||||||| | |||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
29060324 |
tgaacaagtaagaataaggacacccttgattttctttttcttgatttattggttattgtgtcatttgagatgttgttgatgatgattatgatgat |
29060230 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 75; Significance: 1e-34; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 134 - 228
Target Start/End: Complemental strand, 48834682 - 48834588
Alignment:
| Q |
134 |
tgaacaagtaagaataaggacaccgttgattttttctttcttgatttaatggttattgtgccatttgagatgttgttgatgatgattatgatgat |
228 |
Q |
| |
|
|||||||||||||||||||||||| |||||||| | |||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
48834682 |
tgaacaagtaagaataaggacacccttgattttctttttcttgatttattggttattgtgtcatttgagatgttgttgatgatgattatgatgat |
48834588 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 37; Significance: 0.000000000006; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 59 - 107
Target Start/End: Original strand, 1805477 - 1805525
Alignment:
| Q |
59 |
ctgatctgggtatgtattattttctttattattagagcatgttgaaaaa |
107 |
Q |
| |
|
||||||||||| ||| |||||||||| |||||||||||||||||||||| |
|
|
| T |
1805477 |
ctgatctgggtctgtcttattttcttcattattagagcatgttgaaaaa |
1805525 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 56 - 116
Target Start/End: Original strand, 6640123 - 6640183
Alignment:
| Q |
56 |
tttctgatctgggtatgtattattttctttattattagagcatgttgaaaaacccctttga |
116 |
Q |
| |
|
|||||||||||||| ||| ||||||| || ||| |||||||||| |||||||||| ||||| |
|
|
| T |
6640123 |
tttctgatctgggtttgtgttatttttttcatttttagagcatgctgaaaaacccttttga |
6640183 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 56 - 107
Target Start/End: Original strand, 32321147 - 32321198
Alignment:
| Q |
56 |
tttctgatctgggtatgtattattttctttattattagagcatgttgaaaaa |
107 |
Q |
| |
|
|||||||||||||| || |||||||||| |||||||||| ||||||||||| |
|
|
| T |
32321147 |
tttctgatctgggtttgacttattttcttcattattagagtatgttgaaaaa |
32321198 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2725 times since January 2019
Visitors: 4801