View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0760_high_9 (Length: 399)
Name: NF0760_high_9
Description: NF0760
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0760_high_9 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 89; Significance: 9e-43; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 89; E-Value: 9e-43
Query Start/End: Original strand, 287 - 379
Target Start/End: Original strand, 21580625 - 21580717
Alignment:
| Q |
287 |
gggttgtaattgtaaatgaactgtgatgggttgaattgttttccataatacacctcttgagaggtgatgtcttgctgctgtctttgatgatgt |
379 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
21580625 |
gggttgtaattgtaaatgaactgtgatgggttgaattgttttccataatacacctcttgagaggtgatgtcttgctgctgtctttggtgatgt |
21580717 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 61; E-Value: 4e-26
Query Start/End: Original strand, 98 - 183
Target Start/End: Original strand, 21580424 - 21580509
Alignment:
| Q |
98 |
tattatctaccttgaagaacttgtagaaataagctaaaataagctttctcnnnnnnnaaataagctaaaataagcttacgtgttgg |
183 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
21580424 |
tattagctaccttgaagaacttgtagaaataagctaaaataagctttctctttttttaaataagctaaaataagcttacgtgttgg |
21580509 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University