View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0760_low_15 (Length: 424)
Name: NF0760_low_15
Description: NF0760
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0760_low_15 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 87; Significance: 1e-41; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 87; E-Value: 1e-41
Query Start/End: Original strand, 66 - 184
Target Start/End: Complemental strand, 21657969 - 21657851
Alignment:
Q |
66 |
ttagcaattgatatgataatccatttggccttaacttgatcttcatctctagtttcattttcaccgacaaatggtttttgaaaatctatatactctttaa |
165 |
Q |
|
|
|||| ||||||||||| |||||||||| |||| |||||||||||||||||||||||||||||| ||||| ||| |||||||||||||||||||||||||| |
|
|
T |
21657969 |
ttagtaattgatatgagaatccatttgaccttgacttgatcttcatctctagtttcattttcatcgacatatgatttttgaaaatctatatactctttaa |
21657870 |
T |
 |
Q |
166 |
ttagcttgcaccttttttc |
184 |
Q |
|
|
|||||||||| |||||||| |
|
|
T |
21657869 |
ttagcttgcatcttttttc |
21657851 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 54; Significance: 7e-22; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 54; E-Value: 7e-22
Query Start/End: Original strand, 322 - 391
Target Start/End: Complemental strand, 30366037 - 30365969
Alignment:
Q |
322 |
aagcagctaacagagccataaattgtgatttggttgagtgaaatcgaacagagcaacaacaacagtgaac |
391 |
Q |
|
|
|||||||||||||||| | |||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
30366037 |
aagcagctaacagagcaa-aaatcgtgatttggttgagtgaaatcgaacagagcaacaacaacagtgaac |
30365969 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 25 - 57
Target Start/End: Complemental strand, 30366138 - 30366106
Alignment:
Q |
25 |
catcatacgagaccacaaaccacaaaattcctt |
57 |
Q |
|
|
||||||||||||||||||||||||||||||||| |
|
|
T |
30366138 |
catcatacgagaccacaaaccacaaaattcctt |
30366106 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University