View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0760_low_23 (Length: 385)
Name: NF0760_low_23
Description: NF0760
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0760_low_23 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 147; Significance: 2e-77; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 147; E-Value: 2e-77
Query Start/End: Original strand, 77 - 256
Target Start/End: Original strand, 60935 - 61124
Alignment:
Q |
77 |
tattgtattgtatgcaaaatgtcagatccaacttcattctctagaaagctaattagctaaatacaat----------gcaattctaggaagtacgaatgc |
166 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
T |
60935 |
tattgtattgtatgcaaaatgtcagatccaacttcattctctagaaagctaattagctaaatacaatgcaatgcaatgcaattctaggaagtacgaatgc |
61034 |
T |
 |
Q |
167 |
atacatggacattggccacactattagtattgatacgttgatactagtagtaatgtaagaaaatgacatgattgcaattcaatcacatgt |
256 |
Q |
|
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
T |
61035 |
atacacggacattggccacactattagtattgatacgttgatactagtagtaatgtaagaaaatgacatgattgcaattcaatcgcatgt |
61124 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 63; E-Value: 3e-27
Query Start/End: Original strand, 252 - 325
Target Start/End: Original strand, 61212 - 61286
Alignment:
Q |
252 |
catgttataataacaataacaaattaaaaag-aaatatgtctgggcaggatcattcgatcaaaagtgtctgtgct |
325 |
Q |
|
|
||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||| |
|
|
T |
61212 |
catgttataataacaataacaaattaaaaaggaaatatgtctgggtaggatcattcgatcaaaagtgtctgtgct |
61286 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University