View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0760_low_24 (Length: 378)
Name: NF0760_low_24
Description: NF0760
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0760_low_24 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 128; Significance: 4e-66; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 128; E-Value: 4e-66
Query Start/End: Original strand, 210 - 349
Target Start/End: Complemental strand, 44667680 - 44667541
Alignment:
Q |
210 |
aatgataaattgtagagtgtggtgagtgatgaggggatataagaaaaataatggcagtagttaattggtggcggatgttaagtatgagcttctagatttt |
309 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||| |
|
|
T |
44667680 |
aatgataaattgtagagtgtggtgagtgatgaggggataaaagaaaaataatggcagtagttaattggtggtggatgttaagtatgaggttctagatttt |
44667581 |
T |
 |
Q |
310 |
tctgatgtgattgatgagaatgaagaggatgaaagatttg |
349 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
T |
44667580 |
tctgatgtgattgatgagaatgaagaggatgaaagatttg |
44667541 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 81; E-Value: 5e-38
Query Start/End: Original strand, 42 - 173
Target Start/End: Complemental strand, 44667840 - 44667719
Alignment:
Q |
42 |
cctgtgagagagaagccatttgttgaagaaaaagaaggattgaattgagttgagttgacttgattagaaaggaagaagagttgtatagatatatagaggt |
141 |
Q |
|
|
||||||| ||||||| ||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||| |
|
|
T |
44667840 |
cctgtgaaagagaagtcatttgttgaagaaaaagaaggattgaattgagttgact----------agaaaggaagaagagttgtatagatatatagaggt |
44667751 |
T |
 |
Q |
142 |
gggtgtaggtgagattgcttaatggaagatat |
173 |
Q |
|
|
||||||||||||||||||||||||| |||||| |
|
|
T |
44667750 |
gggtgtaggtgagattgcttaatgggagatat |
44667719 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University