View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0760_low_24 (Length: 378)

Name: NF0760_low_24
Description: NF0760
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0760_low_24
NF0760_low_24
[»] chr2 (2 HSPs)
chr2 (210-349)||(44667541-44667680)
chr2 (42-173)||(44667719-44667840)


Alignment Details
Target: chr2 (Bit Score: 128; Significance: 4e-66; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 128; E-Value: 4e-66
Query Start/End: Original strand, 210 - 349
Target Start/End: Complemental strand, 44667680 - 44667541
Alignment:
210 aatgataaattgtagagtgtggtgagtgatgaggggatataagaaaaataatggcagtagttaattggtggcggatgttaagtatgagcttctagatttt 309  Q
    ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||| |||||||||||    
44667680 aatgataaattgtagagtgtggtgagtgatgaggggataaaagaaaaataatggcagtagttaattggtggtggatgttaagtatgaggttctagatttt 44667581  T
310 tctgatgtgattgatgagaatgaagaggatgaaagatttg 349  Q
    ||||||||||||||||||||||||||||||||||||||||    
44667580 tctgatgtgattgatgagaatgaagaggatgaaagatttg 44667541  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 81; E-Value: 5e-38
Query Start/End: Original strand, 42 - 173
Target Start/End: Complemental strand, 44667840 - 44667719
Alignment:
42 cctgtgagagagaagccatttgttgaagaaaaagaaggattgaattgagttgagttgacttgattagaaaggaagaagagttgtatagatatatagaggt 141  Q
    ||||||| ||||||| ||||||||||||||||||||||||||||||||||||| |          |||||||||||||||||||||||||||||||||||    
44667840 cctgtgaaagagaagtcatttgttgaagaaaaagaaggattgaattgagttgact----------agaaaggaagaagagttgtatagatatatagaggt 44667751  T
142 gggtgtaggtgagattgcttaatggaagatat 173  Q
    ||||||||||||||||||||||||| ||||||    
44667750 gggtgtaggtgagattgcttaatgggagatat 44667719  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University