View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0760_low_30 (Length: 341)
Name: NF0760_low_30
Description: NF0760
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0760_low_30 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 293; Significance: 1e-164; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 293; E-Value: 1e-164
Query Start/End: Original strand, 3 - 319
Target Start/End: Original strand, 8205161 - 8205477
Alignment:
Q |
3 |
catctccaacaatatcaaattgagaaatcatagcttgacactcatctatacttctacactcacccaatcttccaagcattctctttagactctttggtgt |
102 |
Q |
|
|
|||||||| ||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
8205161 |
catctccatcaatatcaaattgagaaatcatagcttgacattcatctacacttctacactcacccaatcttccaagcattctctttagactctttggtgt |
8205260 |
T |
 |
Q |
103 |
gatgcaaccacatccctccatttcatacatcttaaaagcctctcttaggtcatttactttctcttcctctttccctccctctacaaacttcacaaaatca |
202 |
Q |
|
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
8205261 |
gatgcaaccacatccttccatttcatacatcttaaaagcctctcttaggtcatttactttctcttcctctttccctccctctacaaacttcacaaaatca |
8205360 |
T |
 |
Q |
203 |
tccaacccaatcaacccatcaccgtccgagtcgagaagctcaaccgccatttccgcctcctcgttcgacatctttgccccgattgcctcaacacattgcc |
302 |
Q |
|
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
T |
8205361 |
tccaacccaatcaacccatccccgtccgagtcgagaagctcaaccgccatttccgcctcctcgtttgacatctttgccccgattgcctcaacacattgcc |
8205460 |
T |
 |
Q |
303 |
gcagctccgatgatgat |
319 |
Q |
|
|
||||||||||||||||| |
|
|
T |
8205461 |
gcagctccgatgatgat |
8205477 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University