View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0760_low_33 (Length: 337)
Name: NF0760_low_33
Description: NF0760
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0760_low_33 |
 |  |
|
[»] scaffold0064 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr1 (Bit Score: 119; Significance: 9e-61; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 119; E-Value: 9e-61
Query Start/End: Original strand, 37 - 195
Target Start/End: Complemental strand, 3325092 - 3324934
Alignment:
Q |
37 |
tgttactcatggtactattgaatatnnnnnnnntgactactttgtgaattatgggcatgtgtctactgtctctaggggtgggcaaaaatatccaaaaact |
136 |
Q |
|
|
||||||||||||||||||||||||| |||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||| | |
|
|
T |
3325092 |
tgttactcatggtactattgaatataaaaaaaatgactactttgtgaattatgtgcatgtgtccactgtctctaggggtgggcaaaaatatccaaaaatt |
3324993 |
T |
 |
Q |
137 |
gaaccgaactgaaccaaactaaaattaactgaaccattacattggttattgaaccgaac |
195 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
T |
3324992 |
gaaccgaactgaaccaaactaaaattaactgaaccattacattggttattaaaccgaac |
3324934 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 108 - 195
Target Start/End: Complemental strand, 48315225 - 48315143
Alignment:
Q |
108 |
ctaggggtgggcaaaaatatccaaaaactgaaccgaactgaaccaaactaaaattaactgaaccattacattggttattgaaccgaac |
195 |
Q |
|
|
|||||| ||| ||||||||||||||||| ||| ||||| |||||||||||||||||||||||||||||| ||||| || ||||| |
|
|
T |
48315225 |
ctagggatggccaaaaatatccaaaaaccgaatcgaac-----caaactaaaattaactgaaccattacattgattattaaatcgaac |
48315143 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 226 - 257
Target Start/End: Complemental strand, 3324694 - 3324663
Alignment:
Q |
226 |
cgatggcttcttcttcactacttcttttgcct |
257 |
Q |
|
|
|||||||||||||||||||||||||||||||| |
|
|
T |
3324694 |
cgatggcttcttcttcactacttcttttgcct |
3324663 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 112; Significance: 1e-56; HSPs: 4)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 112; E-Value: 1e-56
Query Start/End: Original strand, 82 - 197
Target Start/End: Complemental strand, 10227434 - 10227319
Alignment:
Q |
82 |
gaattatgggcatgtgtctactgtctctaggggtgggcaaaaatatccaaaaactgaaccgaactgaaccaaactaaaattaactgaaccattacattgg |
181 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
10227434 |
gaattatgggcatgtgtctactgtctctaggggtgggcaaaaatatccaaaaactgaaccgaactgaaccaaactaaaattaactgaaccattacattgg |
10227335 |
T |
 |
Q |
182 |
ttattgaaccgaactg |
197 |
Q |
|
|
||||| |||||||||| |
|
|
T |
10227334 |
ttattaaaccgaactg |
10227319 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 95; E-Value: 2e-46
Query Start/End: Original strand, 138 - 257
Target Start/End: Complemental strand, 10227328 - 10227209
Alignment:
Q |
138 |
aaccgaactgaaccaaactaaaattaactgaaccattacattggttattgaaccgaactgnnnnnnnaaaaaagttcatcaactgtaccgatggcttctt |
237 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||| |
|
|
T |
10227328 |
aaccgaactgaaccaaactaaaattaactgaaccattacattggttattgaaccgaaccgttttttaaaaaaagttcatcaactgtaccgatggcttctt |
10227229 |
T |
 |
Q |
238 |
cttcactacttcttttgcct |
257 |
Q |
|
|
|||||||||||||||||||| |
|
|
T |
10227228 |
cttcactacttcttttgcct |
10227209 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 138 - 195
Target Start/End: Original strand, 28733209 - 28733266
Alignment:
Q |
138 |
aaccgaactgaaccaaactaaaattaactgaaccattacattggttattgaaccgaac |
195 |
Q |
|
|
|||| ||| |||| |||||||||||||||||| |||||||||||||||| ||| |||| |
|
|
T |
28733209 |
aaccaaaccgaactaaactaaaattaactgaatcattacattggttattaaacagaac |
28733266 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 138 - 195
Target Start/End: Complemental strand, 42476615 - 42476558
Alignment:
Q |
138 |
aaccgaactgaaccaaactaaaattaactgaaccattacattggttattgaaccgaac |
195 |
Q |
|
|
||||||||||||||||||||||||||||| ||| ||| ||| |||||||||| |||| |
|
|
T |
42476615 |
aaccgaactgaaccaaactaaaattaactaaactattgtattagttattgaactgaac |
42476558 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 71; Significance: 4e-32; HSPs: 6)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 71; E-Value: 4e-32
Query Start/End: Original strand, 109 - 195
Target Start/End: Complemental strand, 2737844 - 2737758
Alignment:
Q |
109 |
taggggtgggcaaaaatatccaaaaactgaaccgaactgaaccaaactaaaattaactgaaccattacattggttattgaaccgaac |
195 |
Q |
|
|
|||||||||| ||||||||| |||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
T |
2737844 |
taggggtgggtaaaaatatctaaaaactgaaccgaaccgaaccaaattaaaattaactgaaccattacattggttattgaaccgaac |
2737758 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 110 - 195
Target Start/End: Complemental strand, 38372776 - 38372691
Alignment:
Q |
110 |
aggggtgggcaaaaatatccaaaaactgaaccgaactgaaccaaactaaaattaactgaaccattacattggttattgaaccgaac |
195 |
Q |
|
|
|||||||||||||||||| ||||| ||| ||||| |||| ||||||||||||||||||| ||| |||||||||||||||||||| |
|
|
T |
38372776 |
aggggtgggcaaaaatatttaaaaatcgaatcgaaccgaactaaactaaaattaactgaactattgcattggttattgaaccgaac |
38372691 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 109 - 189
Target Start/End: Original strand, 45065538 - 45065613
Alignment:
Q |
109 |
taggggtgggcaaaaatatccaaaaactgaaccgaactgaaccaaactaaaattaactgaaccattacattggttattgaa |
189 |
Q |
|
|
||||| ||||||||||||||||||||| ||||||||| ||||||||||||| ||||| ||||||||||||||||||| |
|
|
T |
45065538 |
tagggatgggcaaaaatatccaaaaaccgaaccgaac-----caaactaaaattagctgaatcattacattggttattgaa |
45065613 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 146 - 195
Target Start/End: Original strand, 39264726 - 39264775
Alignment:
Q |
146 |
tgaaccaaactaaaattaactgaaccattacattggttattgaaccgaac |
195 |
Q |
|
|
|||||||||||||||||||| |||||||||||||||||||||||| |||| |
|
|
T |
39264726 |
tgaaccaaactaaaattaaccgaaccattacattggttattgaactgaac |
39264775 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 138 - 191
Target Start/End: Complemental strand, 48997150 - 48997097
Alignment:
Q |
138 |
aaccgaactgaaccaaactaaaattaactgaaccattacattggttattgaacc |
191 |
Q |
|
|
||||||||||||||||| |||||||||| |||||| ||||||||||||| |||| |
|
|
T |
48997150 |
aaccgaactgaaccaaattaaaattaaccgaaccactacattggttattaaacc |
48997097 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 107 - 140
Target Start/End: Original strand, 39264674 - 39264707
Alignment:
Q |
107 |
tctaggggtgggcaaaaatatccaaaaactgaac |
140 |
Q |
|
|
|||||||||||||||||||||||||||||||||| |
|
|
T |
39264674 |
tctaggggtgggcaaaaatatccaaaaactgaac |
39264707 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 64; Significance: 6e-28; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 64; E-Value: 6e-28
Query Start/End: Original strand, 114 - 193
Target Start/End: Original strand, 23757669 - 23757748
Alignment:
Q |
114 |
gtgggcaaaaatatccaaaaactgaaccgaactgaaccaaactaaaattaactgaaccattacattggttattgaaccga |
193 |
Q |
|
|
|||| |||||||||| |||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
T |
23757669 |
gtggacaaaaatatcaaaaaactgaaccgaaccgaaccaaactaaaattaattgaaccattacattggttattgaaccga |
23757748 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 109 - 195
Target Start/End: Original strand, 12197380 - 12197469
Alignment:
Q |
109 |
taggggtgggcaaaaatatccaaaaactgaaccgaactg---aaccaaactaaaattaactgaaccattacattggttattgaaccgaac |
195 |
Q |
|
|
|||||||| ||||||||| |||||||| ||||||||| | |||| ||| ||||||||| ||||||||||| ||||||||||||||||| |
|
|
T |
12197380 |
taggggtgagcaaaaataaccaaaaaccgaaccgaacggccaaaccgaaccaaaattaaccgaaccattacactggttattgaaccgaac |
12197469 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 63; Significance: 2e-27; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 113 - 195
Target Start/End: Complemental strand, 23112158 - 23112076
Alignment:
Q |
113 |
ggtgggcaaaaatatccaaaaactgaaccgaactgaaccaaactaaaattaactgaaccattacattggttattgaaccgaac |
195 |
Q |
|
|
||||||||||||||||||||||||||||||||| ||||||||| |||||||| | |||||||||| ||||||||||||||||| |
|
|
T |
23112158 |
ggtgggcaaaaatatccaaaaactgaaccgaaccgaaccaaacgaaaattaattaaaccattacagtggttattgaaccgaac |
23112076 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 50; Significance: 1e-19; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 138 - 195
Target Start/End: Original strand, 37344564 - 37344621
Alignment:
Q |
138 |
aaccgaactgaaccaaactaaaattaactgaaccattacattggttattgaaccgaac |
195 |
Q |
|
|
|||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
T |
37344564 |
aaccgaactgaatcaaactaaaattaactgaatcattacattggttattgaaccgaac |
37344621 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 109 - 139
Target Start/End: Original strand, 37344522 - 37344552
Alignment:
Q |
109 |
taggggtgggcaaaaatatccaaaaactgaa |
139 |
Q |
|
|
||||||||||||||||||||||||||||||| |
|
|
T |
37344522 |
taggggtgggcaaaaatatccaaaaactgaa |
37344552 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 43; Significance: 0.000000000000002; HSPs: 4)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 113 - 195
Target Start/End: Original strand, 50301813 - 50301894
Alignment:
Q |
113 |
ggtgggcaaaaatatccaaaaactgaaccgaactgaaccaaactaaaattaactgaaccattacattggttattgaaccgaac |
195 |
Q |
|
|
||||||||||||||||| |||| | || |||| || |||||||||||||||||||||||||||||||||||||| |||||| |
|
|
T |
50301813 |
ggtgggcaaaaatatcctaaaagtagac-gaacaaaatcaaactaaaattaactgaaccattacattggttattgatccgaac |
50301894 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 140 - 191
Target Start/End: Original strand, 32862054 - 32862105
Alignment:
Q |
140 |
ccgaactgaaccaaactaaaattaactgaaccattacattggttattgaacc |
191 |
Q |
|
|
|||||||||||||||||||||||||||||| |||| |||| |||||||||| |
|
|
T |
32862054 |
ccgaactgaaccaaactaaaattaactgaatcattgcattatttattgaacc |
32862105 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 109 - 150
Target Start/End: Original strand, 25638460 - 25638501
Alignment:
Q |
109 |
taggggtgggcaaaaatatccaaaaactgaaccgaactgaac |
150 |
Q |
|
|
|||||||||||||||||| |||||||||||||||||| |||| |
|
|
T |
25638460 |
taggggtgggcaaaaataaccaaaaactgaaccgaaccgaac |
25638501 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 152 - 195
Target Start/End: Original strand, 10773480 - 10773523
Alignment:
Q |
152 |
aaactaaaattaactgaaccattacattggttattgaaccgaac |
195 |
Q |
|
|
||||||||||||||||||||||| |||| |||||||||||||| |
|
|
T |
10773480 |
aaactaaaattaactgaaccattttattgattattgaaccgaac |
10773523 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0064 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: scaffold0064
Description:
Target: scaffold0064; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 147 - 195
Target Start/End: Original strand, 53246 - 53294
Alignment:
Q |
147 |
gaaccaaactaaaattaactgaaccattacattggttattgaaccgaac |
195 |
Q |
|
|
|||||| |||||||||||| ||||||||| ||||||||| ||||||||| |
|
|
T |
53246 |
gaaccatactaaaattaaccgaaccattatattggttatcgaaccgaac |
53294 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University