View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0760_low_37 (Length: 327)
Name: NF0760_low_37
Description: NF0760
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0760_low_37 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 154; Significance: 1e-81; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 154; E-Value: 1e-81
Query Start/End: Original strand, 160 - 321
Target Start/End: Original strand, 48288986 - 48289147
Alignment:
Q |
160 |
acttaaactatatcatattcatatgtagatgttaccttggattggggctgtttttcaccatcttctttccgtacttcctccatctgaacccgtcatccag |
259 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
T |
48288986 |
acttaaactatatcatattcatatgtagatgttaccttggattggggctgtttttcaccatcttctttccgtacttcctccatctgaacccatcatccag |
48289085 |
T |
 |
Q |
260 |
aatttcaacctctgacttggttttgaatgcaactttatgatctctaatttccttcatctcac |
321 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
T |
48289086 |
aatttcaacctctgacttggttttgaatgcaactttatgatctctaatttccttcttctcac |
48289147 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 46 - 93
Target Start/End: Original strand, 48288911 - 48288958
Alignment:
Q |
46 |
tatagtagttcctgtaatcaaattggaaattctctcaattaacataaa |
93 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
48288911 |
tatagtagttcctgtaatcaaattggaaattctctcaattaacataaa |
48288958 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 46; Significance: 3e-17; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 192 - 293
Target Start/End: Original strand, 3734425 - 3734526
Alignment:
Q |
192 |
taccttggattggggctgtttttcaccatcttctttccgtacttcctccatctgaacccgtcatccagaatttcaacctctgacttggttttgaatgcaa |
291 |
Q |
|
|
||||||||||| ||||| || || ||||| |||||||| ||||||||||||||| |||| ||||| || ||||||| | |||||| ||||||||||||| |
|
|
T |
3734425 |
taccttggattagggctattcttaaccattttctttccatacttcctccatctgtacccatcatcaagtatttcaatcagtgactttgttttgaatgcaa |
3734524 |
T |
 |
Q |
292 |
ct |
293 |
Q |
|
|
|| |
|
|
T |
3734525 |
ct |
3734526 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2794 times since January 2019
Visitors: 4801