View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0760_low_38 (Length: 325)
Name: NF0760_low_38
Description: NF0760
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0760_low_38 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 131; Significance: 6e-68; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 131; E-Value: 6e-68
Query Start/End: Original strand, 95 - 233
Target Start/End: Complemental strand, 37128164 - 37128026
Alignment:
| Q |
95 |
ttttttgaataaaccatcaatttagtccctagagtatatgaaatctgtgaatttagtcataagatcttaaccagagagactaaattaatgaattttatac |
194 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37128164 |
ttttttgaataaaccatcaatttagtccctagagtatatgaaatctgtgaatttagtcataagatcttaaccagagagactaaattaatgaattttatag |
37128065 |
T |
|
| Q |
195 |
agtttagggattacttgctatatatttacttaaattgat |
233 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
37128064 |
agtttagggattactagctatatatttacttaaattgat |
37128026 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 29; Significance: 0.0000004; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 101 - 133
Target Start/End: Complemental strand, 26004491 - 26004459
Alignment:
| Q |
101 |
gaataaaccatcaatttagtccctagagtatat |
133 |
Q |
| |
|
||||||||||||||||||||||||| ||||||| |
|
|
| T |
26004491 |
gaataaaccatcaatttagtccctaaagtatat |
26004459 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 116 - 152
Target Start/End: Original strand, 41811843 - 41811879
Alignment:
| Q |
116 |
ttagtccctagagtatatgaaatctgtgaatttagtc |
152 |
Q |
| |
|
|||||||||| |||||||||||||||| ||||||||| |
|
|
| T |
41811843 |
ttagtccctaaagtatatgaaatctgtcaatttagtc |
41811879 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 4118 times since January 2019
Visitors: 4827