View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0760_low_40 (Length: 313)
Name: NF0760_low_40
Description: NF0760
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0760_low_40 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 254; Significance: 1e-141; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 254; E-Value: 1e-141
Query Start/End: Original strand, 23 - 308
Target Start/End: Complemental strand, 42364909 - 42364624
Alignment:
| Q |
23 |
cagtttcaattgagttttatcacttcatccttcaaggcacaagacatcacttgcatgcacacataccaagtaaggggattagcaatgtcctgaatgagct |
122 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||| |
|
|
| T |
42364909 |
cagtttcaattgagttttatcacttcatccttcaaagcacaagacatcacttgcatgcacacataccaagtaaggggattagcaatgtactgaataagct |
42364810 |
T |
|
| Q |
123 |
acataggttcaagtctcattatcctaaccgcgcatatacaaatttgtagcttaactcagttgatagagagttgattcatatgcaatatgatgggtttaac |
222 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||| || | ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42364809 |
acataggttcaagtctcattctcctaaccgcgcatatacaaatttgtagtttgattcagttgatagagagttgattcatatgcaatatgatgggtttaac |
42364710 |
T |
|
| Q |
223 |
ttccgctattagtgtaagaatatttttattggctgatatgtaagctgaccttatattagtggtcagtccttaaaattcatctcact |
308 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
42364709 |
ttccgctattagtgtaagaatatttttattggctgatatgtaagctgaccttatattagtgatcagtccttaaaattcatctcact |
42364624 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 4086 times since January 2019
Visitors: 4827