View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0760_low_50 (Length: 279)
Name: NF0760_low_50
Description: NF0760
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0760_low_50 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 69; Significance: 5e-31; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 69; E-Value: 5e-31
Query Start/End: Original strand, 15 - 91
Target Start/End: Original strand, 52815665 - 52815741
Alignment:
Q |
15 |
atgtgagttttaagtgatgatttatttaagtaagtaagaacattgaattgaatattttttattattaattaatgata |
91 |
Q |
|
|
|||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||| |
|
|
T |
52815665 |
atgtgagttttaagtgatgatttatttaagtaagaaagaatattgaattgaatattttttattattaattaatgata |
52815741 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University