View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0760_low_50 (Length: 279)

Name: NF0760_low_50
Description: NF0760
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0760_low_50
NF0760_low_50
[»] chr1 (1 HSPs)
chr1 (15-91)||(52815665-52815741)


Alignment Details
Target: chr1 (Bit Score: 69; Significance: 5e-31; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 69; E-Value: 5e-31
Query Start/End: Original strand, 15 - 91
Target Start/End: Original strand, 52815665 - 52815741
Alignment:
15 atgtgagttttaagtgatgatttatttaagtaagtaagaacattgaattgaatattttttattattaattaatgata 91  Q
    |||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||    
52815665 atgtgagttttaagtgatgatttatttaagtaagaaagaatattgaattgaatattttttattattaattaatgata 52815741  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 2984 times since January 2019
Visitors: 4805