View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0760_low_51 (Length: 279)
Name: NF0760_low_51
Description: NF0760
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0760_low_51 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 177; Significance: 2e-95; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 20 - 244
Target Start/End: Complemental strand, 52815668 - 52815445
Alignment:
| Q |
20 |
acattcaattttaataatgctgtgcaacagaaatggatgctttaggaaccaaatccaagcattgcacaaagtttttcaggttcaaatcttcttttacttt |
119 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52815668 |
acattcaattttaataatgttgtgcaacagaaatggatgttttaggaaccaaatccaagccttgcacaaagtttttcaggttcaaatcttcttttacttt |
52815569 |
T |
|
| Q |
120 |
tctaaaatcaattcggtaattaaggctctactgtgctacaggtttaccgctaatcacttctcttaagtactaaaagaaagatgatgctgatcaattaaat |
219 |
Q |
| |
|
||||||||||| ||||||| ||||||||||| |||||||||||||||||||||||| |||||||||||||||||| | |||||||||||||||||||||| |
|
|
| T |
52815568 |
tctaaaatcaactcggtaaataaggctctacagtgctacaggtttaccgctaatcatttctcttaagtactaaaa-agagatgatgctgatcaattaaat |
52815470 |
T |
|
| Q |
220 |
gcctagagacatgttatatccaaac |
244 |
Q |
| |
|
|||||| |||||||| ||||||||| |
|
|
| T |
52815469 |
gcctagcgacatgttctatccaaac |
52815445 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 3123 times since January 2019
Visitors: 4805