View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0760_low_52 (Length: 273)

Name: NF0760_low_52
Description: NF0760
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0760_low_52
NF0760_low_52
[»] chr3 (1 HSPs)
chr3 (101-233)||(304530-304659)


Alignment Details
Target: chr3 (Bit Score: 111; Significance: 4e-56; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 111; E-Value: 4e-56
Query Start/End: Original strand, 101 - 233
Target Start/End: Complemental strand, 304659 - 304530
Alignment:
101 tttgtattgatgttatatatgttacagggtttgatgtcgtagacaagggatgctgtggtgttggcagaaacaatggacaaatcacttgtcttccattaca 200  Q
    ||||||||||||||||   || |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||    
304659 tttgtattgatgttat---tgatacagggtttgatgtcgtagacaagggatgctgtggtgttggaagaaacaatggacaaatcacttgtcttccattaca 304563  T
201 acaagtatgtgaagatcgtgggaaatatttgtt 233  Q
    |||||||||||||||||||||||||||||||||    
304562 acaagtatgtgaagatcgtgggaaatatttgtt 304530  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University