View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0760_low_52 (Length: 273)
Name: NF0760_low_52
Description: NF0760
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0760_low_52 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 111; Significance: 4e-56; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 111; E-Value: 4e-56
Query Start/End: Original strand, 101 - 233
Target Start/End: Complemental strand, 304659 - 304530
Alignment:
Q |
101 |
tttgtattgatgttatatatgttacagggtttgatgtcgtagacaagggatgctgtggtgttggcagaaacaatggacaaatcacttgtcttccattaca |
200 |
Q |
|
|
|||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
T |
304659 |
tttgtattgatgttat---tgatacagggtttgatgtcgtagacaagggatgctgtggtgttggaagaaacaatggacaaatcacttgtcttccattaca |
304563 |
T |
 |
Q |
201 |
acaagtatgtgaagatcgtgggaaatatttgtt |
233 |
Q |
|
|
||||||||||||||||||||||||||||||||| |
|
|
T |
304562 |
acaagtatgtgaagatcgtgggaaatatttgtt |
304530 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 3441 times since January 2019
Visitors: 4814