View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0760_low_54 (Length: 271)
Name: NF0760_low_54
Description: NF0760
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0760_low_54 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 41 - 245
Target Start/End: Original strand, 8324164 - 8324368
Alignment:
| Q |
41 |
acatcatcatcttgaagtactttcatctccgatagtaacggaattccaacccagaaatctctaaaataccctccaacttccccgactatgttgcagaaac |
140 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
8324164 |
acatcatcatcttgaagtactttcatctccgatagtaacggaattccaacccagaaatctctaaaataccctccaacttccccgactatgttgcagagac |
8324263 |
T |
|
| Q |
141 |
ccagacgccgttgcgaaggcacagccatgggcgctatcgttcttgatcttcgtcccggtctcggaatcggtcctttctcccttggtaattttctcttcat |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
8324264 |
ccagacgccgttgcgaaggcacagccatgggcgctatcgttcttgatcttcgtcccggtctcggaatcggtcctttctccctcggtaattttctcttcat |
8324363 |
T |
|
| Q |
241 |
ctcac |
245 |
Q |
| |
|
|||| |
|
|
| T |
8324364 |
ttcac |
8324368 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 3007 times since January 2019
Visitors: 4805