View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0760_low_54 (Length: 271)

Name: NF0760_low_54
Description: NF0760
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0760_low_54
NF0760_low_54
[»] chr5 (1 HSPs)
chr5 (41-245)||(8324164-8324368)


Alignment Details
Target: chr5 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 41 - 245
Target Start/End: Original strand, 8324164 - 8324368
Alignment:
41 acatcatcatcttgaagtactttcatctccgatagtaacggaattccaacccagaaatctctaaaataccctccaacttccccgactatgttgcagaaac 140  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||    
8324164 acatcatcatcttgaagtactttcatctccgatagtaacggaattccaacccagaaatctctaaaataccctccaacttccccgactatgttgcagagac 8324263  T
141 ccagacgccgttgcgaaggcacagccatgggcgctatcgttcttgatcttcgtcccggtctcggaatcggtcctttctcccttggtaattttctcttcat 240  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||    
8324264 ccagacgccgttgcgaaggcacagccatgggcgctatcgttcttgatcttcgtcccggtctcggaatcggtcctttctccctcggtaattttctcttcat 8324363  T
241 ctcac 245  Q
     ||||    
8324364 ttcac 8324368  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 3007 times since January 2019
Visitors: 4805